Stem-loop sequence cel-mir-5549

AccessionMI0019070 (change log)
DescriptionCaenorhabditis elegans miR-5549 stem-loop
Stem-loop
   ac  g    gg      uuuuu      -uugu             guuuuc     a 
5'   ga aggg  agagau     ugggcc     gaaauuaacguga      ugguc u
     || ||||  ||||||     ||||||     |||||||||||||      |||||  
3'   uu uuuc  uuuuug     auuugg     uuuugguuguacu      aucag c
   -u  g    ua      -uuuu      uuguu             -----a     u 
Get sequence
Deep sequencing
4683 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 6971976-6972085 [-]
sense
F31E3.5.2 ; F31E3.5.2; intron 1
Clustered miRNAs
< 10kb from cel-mir-5549
cel-mir-5549chrIII: 6971976-6972085 [-]
cel-mir-2213chrIII: 6968870-6968924 [+]
Database links

Mature sequence cel-miR-5549-5p

Accession MIMAT0022189
Sequence

28 - 

cuugugaaauuaacgugagu

 - 47

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-5549-3p

Accession MIMAT0022190
Sequence

67 - 

ucauguugguuuuuuguuggu

 - 87

Get sequence
Deep sequencing4586 reads, 15 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21810936 "Age-associated changes in expression of small, noncoding RNAs, including microRNAs, in C. elegans" Kato M, Chen X, Inukai S, Zhao H, Slack FJ RNA. 17:1804-1820(2011).