Stem-loop sequence cel-mir-5550

AccessionMI0019071 (change log)
DescriptionCaenorhabditis elegans miR-5550 stem-loop
Stem-loop
   ---u        a c      a ac        a                aaau  g 
5'     gacacucc c guuucu a  cccgccca gauuucauuugcacug    gu u
       |||||||| | |||||| |  |||||||| ||||||||||||||||    ||  
3'     cugugagg g caaaga u  gggcgggu cuaaaguaaacgugac    cg c
   guug        c a      c cu        g                --gc  g 
Get sequence
Deep sequencing
697 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 409762-409872 [+]
antisense
T07A9.3 ; T07A9.3; intron 1
Database links

Mature sequence cel-miR-5550-5p

Accession MIMAT0022191
Sequence

22 - 

ccccgcccaagauuucauuugc

 - 43

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence cel-miR-5550-3p

Accession MIMAT0022192
Sequence

67 - 

caaaugaaaucgugggcggg

 - 86

Get sequence
Deep sequencing686 reads, 14 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21810936 "Age-associated changes in expression of small, noncoding RNAs, including microRNAs, in C. elegans" Kato M, Chen X, Inukai S, Zhao H, Slack FJ RNA. 17:1804-1820(2011).