Stem-loop sequence cel-mir-5551

AccessionMI0019072 (change log)
DescriptionCaenorhabditis elegans miR-5551 stem-loop
Stem-loop
   uuaa   uu      -   g  c   a      u    uc        -u  - u 
5'     uua  uuugga gug ag ugu aauggu ggaa  ugguauaa  gg c u
       |||  |||||| ||| || ||| |||||| ||||  ||||||||  || | c
3'     aau  aaacuu cac uc acg uuacca ucuu  accauauu  uc g g
   -cua   cu      u   a  u   a      u    ua        uu  a a 
Get sequence
Deep sequencing
5870 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 9757508-9757616 [+]
intergenic
Database links

Mature sequence cel-miR-5551-5p

Accession MIMAT0022193
Sequence

23 - 

uguaaaugguuggaaucugguau

 - 45

Get sequence
Deep sequencing5865 reads, 17 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence cel-miR-5551-3p

Accession MIMAT0022194
Sequence

67 - 

accaauuucuuaccauuagcauc

 - 89

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21810936 "Age-associated changes in expression of small, noncoding RNAs, including microRNAs, in C. elegans" Kato M, Chen X, Inukai S, Zhao H, Slack FJ RNA. 17:1804-1820(2011).