Stem-loop sequence cel-mir-5552

AccessionMI0019073 (change log)
DescriptionCaenorhabditis elegans miR-5552 stem-loop
Stem-loop
   --------------         a u    u   a           a       aauac a 
5'               ggucugcua u auuu ugu guuuguagucu gcagacc     c a
                 ||||||||| | |||| ||| ||||||||||| |||||||     |  
3'               ccagacgau a uaaa aca caaacaucaga cgucugg     g a
   uuuuuuuuuuuuuc         c c    c   c           c       guuuc a 
Get sequence
Deep sequencing
1079 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 18036732-18036841 [+]
sense
Y59A8B.6 ; Y59A8B.6; intron 9
Database links

Mature sequence cel-miR-5552-5p

Accession MIMAT0022195
Sequence

18 - 

uguaguuuguagucuagcagacc

 - 40

Get sequence
Deep sequencing341 reads, 14 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence cel-miR-5552-3p

Accession MIMAT0022196
Sequence

59 - 

ucugccagacuacaaaccacaca

 - 81

Get sequence
Deep sequencing735 reads, 11 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21810936 "Age-associated changes in expression of small, noncoding RNAs, including microRNAs, in C. elegans" Kato M, Chen X, Inukai S, Zhao H, Slack FJ RNA. 17:1804-1820(2011).