Stem-loop sequence cel-mir-5553

AccessionMI0019074 (change log)
DescriptionCaenorhabditis elegans miR-5553 stem-loop
Stem-loop
   a     cgca     a                  c  c           uuu   u 
5'  agggu    uuuau cgaaauggucuugccacg gc auccauugauu   aaa c
    |||||    ||||| |||||||||||||||||| || |||||||||||   |||  
3'  uccca    aaaua guuuuaucagaacggugc cg uggguaacuaa   uuu u
   -     -aac     c                  a  a           --u   u 
Get sequence
Deep sequencing
176 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 8077555-8077664 [-]
intergenic
Clustered miRNAs
< 10kb from cel-mir-5553
cel-mir-5553chrX: 8077555-8077664 [-]
cel-mir-784chrX: 8074922-8075009 [-]
Database links

Mature sequence cel-miR-5553-5p

Accession MIMAT0022197
Sequence

27 - 

uugccacgcgccauccauugauu

 - 49

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cel-miR-5553-3p

Accession MIMAT0022198
Sequence

66 - 

ucaauggguagcacguggcaaga

 - 88

Get sequence
Deep sequencing169 reads, 9 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21810936 "Age-associated changes in expression of small, noncoding RNAs, including microRNAs, in C. elegans" Kato M, Chen X, Inukai S, Zhao H, Slack FJ RNA. 17:1804-1820(2011).