Stem-loop sequence mtr-MIR2111a

AccessionMI0019095 (change log)
DescriptionMedicago truncatula miR2111a stem-loop
Gene family MIPF0000754; MIR2111
Literature search

2 open access papers mention mtr-MIR2111a
(8 sentences)

Stem-loop
   ua      -   c  -au              c ug         -   acc  u 
5'   uauugg gau ag   gagauaaucugcau c  agguuuaga aca   ga g
     |||||| ||| ||   |||||||||||||| |  ||||||||| |||   ||  
3'   guaacc cua uc   cucuauuagacgua g  uccgaaucu ugu   cu c
   ac      a   u  cuu              a gu         g   -ca  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mtr-miR2111a-5p

Accession MIMAT0022239
Previous IDsmtr-miR2111v
Sequence

21 - 

uaaucugcauccugagguuua

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR2111a-3p

Accession MIMAT0022240
Previous IDsmtr-miR2111v*
Sequence

68 - 

agccuuggaaugcagauuauc

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1