![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-548at |
|||||
Accession | MI0019137 (change log) | ||||
Symbol | HGNC:MIR548AT | ||||
Description | Homo sapiens miR-548at stem-loop | ||||
Gene family | MIPF0000317; mir-548 | ||||
Literature search |
![]()
56 open access papers mention hsa-mir-548at | ||||
Stem-loop |
-- gccaa 5' aaaaguuauugcgguuuuggcu a |||||||||||||||||||||| 3' uuuucaaugacgccaaaaccgg a ug uaaag |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-548at-5p |
|
Accession | MIMAT0022277 |
Sequence |
1 - aaaaguuauugcgguuuuggcu - 22 |
Deep sequencing | 2380 reads, 120 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
Mature sequence hsa-miR-548at-3p |
|
Accession | MIMAT0022278 |
Sequence |
38 - caaaaccgcaguaacuuuugu - 58 |
Deep sequencing | 256 reads, 43 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
References |
|
1 |
PMID:21911355
"miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades"
Nucleic Acids Res. 40:37-52(2012).
|
2 |
PMID:21980368
"MicroRNAs associated with metastatic prostate cancer"
PLoS One. 6:e24950(2011).
|