Stem-loop sequence mmu-mir-3073b

AccessionMI0019192 (change log)
Symbol MGI:Mir3073b
DescriptionMus musculus miR-3073b stem-loop
Literature search

1 open access papers mention mmu-mir-3073b
(1 sentences)

Stem-loop
   --a          -  a au  a   aucua 
5'    uggucacagu gg c  ca ccc     g
      |||||||||| || |  || |||      
3'    accaguguca cc g  gu ggg     a
   guc          a  - cg  c   aucuc 
Get sequence
Deep sequencing
219 reads, 0 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 112109250-112109309 [-]
antisense
ENSMUST00000079400 ; Aspg-201; intron 1
ENSMUST00000175349 ; Mir3073-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-3073b
mmu-mir-3073bchr12: 112109250-112109309 [-]
mmu-mir-3073achr12: 112109238-112109322 [+]
Database links

Mature sequence mmu-miR-3073b-5p

Accession MIMAT0022375
Sequence

1 - 

auggucacaguggacaucaacc

 - 22

Get sequence
Deep sequencing199 reads, 14 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence mmu-miR-3073b-3p

Accession MIMAT0022376
Sequence

39 - 

cuggcgccaacugugaccacug

 - 60

Get sequence
Deep sequencing18 reads, 10 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).