Stem-loop sequence ath-MIR5628

AccessionMI0019199 (change log)
DescriptionArabidopsis thaliana miR5628 stem-loop
Stem-loop
   g               c             ag      c                        -------    u 
5'  gaacggucgagauga uaaccgauauuau  aaauag gaagauaugauuauagaagaauca       acca c
    ||||||||||||||| |||||||||||||  |||||| ||||||||||||||||||||||||       |||| u
3'  cuugccagcucuacu auugguuauaaua  uuuauu cuucuauacuaauaucuuuuuagu       uggu u
   g               a             cu      a                        ucuucuu    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 17985850-17985995 [+]
intergenic
Database links

Mature sequence ath-miR5628

Accession MIMAT0022387
Sequence

32 - 

gaaauagcgaagauaugauua

 - 52

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).