Stem-loop sequence ath-MIR5629

AccessionMI0019200 (change log)
DescriptionArabidopsis thaliana miR5629 stem-loop
Stem-loop
   uuauuuuuaauuugga               g                           a              cuaucaaaaaguugguauaaucguaccuccgaguuaacuuccgucaacuacccuaacggaaacauauucguauaaucaagaaaagcgauuguacuuauuuacauaau 
5'                 cguuuaauaccucua uauuuaauuuggaagaaaaauaccuua uuaauuuugguuac                                                                                                           u
                   ||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||                                                                                                           a
3'                 gcaaauuauggagau auaaauuaaaccuucuuuuuguggaau aauuaaaaccaaug                                                                                                           a
   ----------------               g                           c              aauaauuuugaaagcaaaaaauuuuucaaccauauuagaauggaagcucaauugaaggcaauugaugggauugccuuaacaauugacaccaauuuugaauugaguac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 3802714-3803062 [+]
intergenic
Database links

Mature sequence ath-miR5629

Accession MIMAT0022388
Sequence

220 - 

uuaggguaguuaacggaaguua

 - 241

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).