Stem-loop sequence ath-MIR5631

AccessionMI0019202 (change log)
DescriptionArabidopsis thaliana miR5631 stem-loop
Stem-loop
              c                 --            aauaucguauuauacaua 
5' aaaauuauguc uuccugccauauuauau  uuaggaaaaaau                  u
   ||||||||||| |||||||||||||||||  ||||||||||||                  a
3' uuuuaauacag aaggacgguauaauaua  aauccuuuuuua                  a
              a                 ua            auaaauucuccgaagaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 7122566-7122688 [-]
intergenic
Database links

Mature sequence ath-miR5631

Accession MIMAT0022390
Sequence

103 - 

uggcaggaaagacauaauuuu

 - 123

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).