Stem-loop sequence ath-MIR5020c

AccessionMI0019203 (change log)
DescriptionArabidopsis thaliana miR5020c stem-loop
Gene family MIPF0001226; MIR5020
Literature search

1 open access papers mention ath-MIR5020c
(6 sentences)

Stem-loop
   g      ggc      au           a      -cc   --      aauca 
5'  agugau   cauggc  ggaagaaggug gacuug   uga  aucgug     a
    ||||||   ||||||  ||||||||||| ||||||   |||  ||||||      
3'  ucacua   guaccg  ccuuuuuccau cugaac   acu  uaguac     a
   g      aua      au           g      auc   au      cucca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 4770538-4770646 [+]
intergenic
Database links

Mature sequence ath-miR5020c

Accession MIMAT0022391
Sequence

13 - 

uggcauggaagaaggugagac

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).