Stem-loop sequence ath-MIR5632

AccessionMI0019204 (change log)
DescriptionArabidopsis thaliana miR5632 stem-loop
Stem-loop
   u                          g    c     a       u            aucaacuaggcuugagcccg 
5'  ugauucucuuauccaacuguaaaucc aaac cuaau uuccuug accacauuccua                    a
    |||||||||||||||||||||||||| |||| ||||| ||||||| ||||||||||||                    a
3'  acuaagagaauagguugauauuuagg uuug gauua aaggaac ugguguaaggau                    a
   a                          -    u     a       u            gacaaaaaaaacaaaaacaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 8392449-8392608 [-]
intergenic
Database links

Mature sequence ath-miR5632-5p

Accession MIMAT0032127
Sequence

1 - 

uugauucucuuauccaacugu

 - 21

Get sequence
Evidence experimental; Illumina [2]

Mature sequence ath-miR5632-3p

Accession MIMAT0022392
Previous IDsath-miR5632
Sequence

132 - 

uuggauuuauaguuggauaag

 - 152

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).
2
PMID:24119003 "Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots" Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA BMC Genomics. 14:701(2013).