Stem-loop sequence ath-MIR5633

AccessionMI0019205 (change log)
DescriptionArabidopsis thaliana miR5633 stem-loop
Stem-loop
            u      uu    a     g    a         c       a     u   uu          uaua                u    auu    u  guaag     --      c   cuu    aa          u    a           -gagaaaaucauau  aa 
5' ucuacaaau cuuugg  ugau ugaag aaag uaugaucau agaaaac gugau uug  uaaagcucgu    uaugauuggauucaua gaga   caag au     cgagu  auaacu agu   guuu  auuauuuuca auug aauuaugugga              gc  a
   ||||||||| ||||||  |||| ||||| |||| ||||||||| ||||||| ||||| |||  ||||||||||    |||||||||||||||| ||||   |||| ||     |||||  |||||| |||   ||||  |||||||||| |||| |||||||||||              ||   
3' agguguuua gaaacc  acua auuuc uuuc auacuagua ucuuuug cacua aau  auuucgagcg    auacuaaucuaaguau cucu   guuc ug     guuca  uauuga uua   cgag  uagugaaagu uaac uuaauacaccu              ug  u
            u      uu    a     a    c         -       a     u   gg          ----                u    aau    -  ---aa     ga      c   ucu    --          u    c           agguacuaaaagau  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 19544751-19545106 [+]
intergenic
Database links

Mature sequence ath-miR5633

Accession MIMAT0022393
Sequence

35 - 

uaugaucaucagaaaacagug

 - 55

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).