Stem-loop sequence ath-MIR5634

AccessionMI0019206 (change log)
DescriptionArabidopsis thaliana miR5634 stem-loop
Stem-loop
   u               u      auu         cg   g  ggcugaugagcgacuuugugaauuuagggucugucugucaauuuggcgggcuguccaugggccaagcgu 
5'  gagggacuuugugaa uuaggg   uuauuauag  gug cu                                                                     c
    ||||||||||||||| ||||||   |||||||||  ||| ||                                                                      
3'  cucucugaaacacuu aauccc   aaugauguu  cac gg                                                                     u
   a               u      acc         aa   g  auagaaacuauauccuagaauuacccgaccuggaccgugaaucauccgaacccggguuuuuggacgcuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 14982320-14982545 [+]
intergenic
Database links

Mature sequence ath-miR5634

Accession MIMAT0022394
Sequence

3 - 

agggacuuugugaauuuaggg

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).