Stem-loop sequence ath-MIR5636

AccessionMI0019208 (change log)
DescriptionArabidopsis thaliana miR5636 stem-loop
Stem-loop
        gu   u  a          gcgc    guuu  uc 
5' agauc  agu gc gagcuugacg    ucau    ac  u
   |||||  ||| || ||||||||||    ||||    ||  u
3' uuugg  ucg cg uucggacugc    agua    ug  u
        au   c  a          ----    -aau  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 18549959-18550036 [+]
intergenic
Database links

Mature sequence ath-miR5636

Accession MIMAT0022396
Sequence

5 - 

cguaguugcagagcuugacgg

 - 25

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).