Stem-loop sequence ath-MIR5637

AccessionMI0019209 (change log)
DescriptionArabidopsis thaliana miR5637 stem-loop
Stem-loop
   a   c      c     g             -           c    gacucuauaaa          uuuuacugcauuguaugccucuaaaauag 
5'  aga caucuc aaugc caacucuauauuu ccucuauuuua aguu           auauaguuga                             a
    ||| |||||| ||||| ||||||||||||| ||||||||||| ||||           ||||||||||                             g
3'  ucu guagag uuacg guugagauauaaa ggagauaaaau ucaa           uauaucaacu                             g
   a   c      u     g             a           c    ---aucucuua          cgauuauuuucucguuagagauguaaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 12270179-12270373 [-]
intergenic
Database links

Mature sequence ath-miR5637

Accession MIMAT0022397
Sequence

13 - 

aaugcgcaacucuauauuucc

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).