Stem-loop sequence ath-MIR5638a

AccessionMI0019210 (change log)
DescriptionArabidopsis thaliana miR5638a stem-loop
Gene family MIPF0001350; MIR5638
Literature search

1 open access papers mention ath-MIR5638a
(1 sentences)

Stem-loop
   ucu       c    a          g            a     cu       ---g     ua    gg           a   u        c    --- u         auaaa              a       u        acua     g  ----------gg    c            a      u        -cauaa      a  -uuca         aaac   u  uc 
5'    uuggaug gaga uguguuuggg acaauuggagca auuga  cccuuac    guuag  ugaa  uuugaaaguga aga uuuuggua guuu   c agaaaguaa     ugaauccaaguuuc agcacau gucuuuac    gugug ca            cugg agccuaccagau accauu ugauuguu      aguguu cc     uauuuugca    cuc ua  c
      ||||||| |||| |||||||||| |||||||||||| |||||  |||||||    |||||  ||||  ||||||||||| ||| |||||||| ||||   | |||||||||     |||||||||||||| ||||||| ||||||||    ||||| ||            |||| |||||||||||| |||||| ||||||||      |||||| ||     |||||||||    ||| ||   
3'    aaccuac cucu acacaaacuc uguuaaccuugu uagcu  gggaaug    caauu  acuu  aaauuuucacu ucu aaaaccau caaa   g uuuuucauu     acuuagguucaaag ucgugug uagaaaug    cacac gu            gauc ucggguggucua ugguaa acuaacaa      uuacaa gg     augaaacgu    gag gu  a
   ---       u    c          a            c     ag       aagg     ga    ga           c   c        a    acu c         ----a              c       u        aaac     -  auuacuacuuaa    -            c      u        uuuacc      -  uugag         ----   c  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 15336705-15337170 [-]
intergenic
Database links

Mature sequence ath-miR5638a

Accession MIMAT0022398
Sequence

374 - 

auaccaaaacucucucacuuu

 - 394

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).