Stem-loop sequence ath-MIR5630b

AccessionMI0019211 (change log)
DescriptionArabidopsis thaliana miR5630b stem-loop
Gene family MIPF0001332; MIR5630
Literature search

1 open access papers mention ath-MIR5630b
(3 sentences)

Stem-loop
   c u    -    g      -  --a     -    ug 
5'  g ggcu aaga cgguuc ug   uggag gcgc  g
    | |||| |||| |||||| ||   ||||| ||||  u
3'  c ucga uucu gcuaag ac   accuu ugcg  u
   u u    a    a      c  caa     g    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 12023526-12023597 [-]
intergenic
Database links

Mature sequence ath-miR5630b

Accession MIMAT0022399
Sequence

5 - 

gcuaagagcgguucugaugga

 - 25

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).