Stem-loop sequence ath-MIR5639

AccessionMI0019212 (change log)
DescriptionArabidopsis thaliana miR5639 stem-loop
Stem-loop
                     a                   a a  -a     cau           uc    ug                  -    g          a  c     a         uau  g          ca      g               ggu             -ua  ---   uug 
5' aguaguccacuguggucu aggcugaaaugcggugacc g cu  gaaaa   gucaauggugg  cuug  aaaggguugacaaagaag ucua ggagacggug ca gucgg ucucuggcc   gu agugcuaaaa  auuaug uauugguugcuuaaa   gucauauugccac   cg   acu   a
   |||||||||||||||||| ||||||||||||||||||| | ||  |||||   |||||||||||  ||||  |||||||||||||||||| |||| |||||||||| || ||||| |||||||||   || ||||||||||  |||||| |||||||||||||||   |||||||||||||   ||   |||    
3' ucaucagguggcaccaga uccgauuuuaugccacugg c ga  cuuuu   uaguuaccacc  gaac  uuucccaacuguuuuuuu agau ccucugucac gu cggcc agagaucgg   ua ucacgauuuu  uaauau auaaccgacgaauuu   caguauaacggug   gu   ugg   g
                     c                   g -  gc     aac           cu    gu                  u    g          c  a     a         ugg  g          uc      a               ---             uug  aag   uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 10356782-10357163 [+]
intergenic
Database links

Mature sequence ath-miR5639-5p

Accession MIMAT0022400
Previous IDsath-miR5639
Sequence

3 - 

uaguccacuguggucuaaggc

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ath-miR5639-3p

Accession MIMAT0032128
Sequence

356 - 

uuuagccucagaccacgguggacu

 - 379

Get sequence
Evidence not experimental

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).