Stem-loop sequence ath-MIR5640

AccessionMI0019213 (change log)
DescriptionArabidopsis thaliana miR5640 stem-loop
Literature search

1 open access papers mention ath-MIR5640
(24 sentences)

Stem-loop
   aa       --              u    uuau    uuu        a   ac   u   u     g     ag  a        a      u       auuuuaa   u     u    a  g         gca            aagu         a   auuagaacuuuuugauucaagcaucugaguguucuau 
5'   ggugagg  aacaugaacaccag uaca    aaac   ccuguguu caa  uua aua uugau agaga  ga uuagauuc ugaaaa auuaauc       ggu aguag acuu uu gcuguucuu   aaaccaauggua    augugauga acc                                     c
     |||||||  |||||||||||||| ||||    ||||   |||||||| |||  ||| ||| ||||| |||||  || |||||||| |||||| |||||||       ||| ||||| |||| || |||||||||   ||||||||||||    ||||||||| |||                                     a
3'   ccacucu  uuguacuugugguc augu    uuug   ggacauaa guu  gau uau aacua ucucu  cu aaucuaag acuuuu ugguuag       cca uuauc ugaa ga ugacaagaa   uuugguuaccau    uacacuacu ugg                                     g
   -c       gg              c    -cuu    uac        a   cc   c   c     g     ca  c        g      c       acauaug   c     c    -  g         aac            ----         c   gguuuauaucaagaauugaaucuaaccgagauuggga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 1653221-1653624 [-]
intergenic
Database links

Mature sequence ath-miR5640

Accession MIMAT0022401
Sequence

66 - 

ugagagaaggaauuagauuca

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).