Stem-loop sequence ath-MIR5641

AccessionMI0019214 (change log)
DescriptionArabidopsis thaliana miR5641 stem-loop
Stem-loop
   ac      a                                                ac     uuccauagcuaauugaaaucccaaauucuucuaucuuccauaucuucuucuaucauuuucuuuaaguuugauuucgaaaucucuaauuuuaucaucuucuuccauuguuugauuucgaaauccuaauucuuccaucuucauccaucuuucuagcuccgucgauuaccaaguaucuccucc 
5'   gaaaca uaaaauccccaauucaauuuugaaaucccuaauucuaucaucuucuuc  ucuuc                                                                                                                                                                                    a
     |||||| ||||||||||||||||||||||||||||||||||||||||||||||||  |||||                                                                                                                                                                                    u
3'   cuuugu guuuuagggguuaaguuaaaauuuuagggauuaagauaguagaagaag  agaag                                                                                                                                                                                    g
   ua      c                                                gu     uuagggauuaagcagguagaagauugaauuaguuugaagguaucgaaaguauaguagaaaauaguagguaccaacgaauuacuucgauaccuuguuucugcaguugguacgcuccuugcaaacccuaacucgacacuucuaagaaggagugcaccuggugaaaaccauauucauauaagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 9022836-9023326 [+]
intergenic
Database links

Mature sequence ath-miR5641

Accession MIMAT0022402
Sequence

433 - 

uggaagaagaugauagaauua

 - 453

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).