Stem-loop sequence ath-MIR5643a

AccessionMI0019216 (change log)
DescriptionArabidopsis thaliana miR5643a stem-loop
Gene family MIPF0001348; MIR5643
Stem-loop
   g        ua   cg  u      uu  cu         cu 
5'  uguagccg  auc  ua gagucu  gu  uuguaucuu  a
    ||||||||  |||  || ||||||  ||  |||||||||   
3'  gcguuggu  uag  au uucgga  ua  aacauagga  a
   a        -c   -a  u      uu  -u         ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 11667797-11667879 [+]
intergenic
Database links

Mature sequence ath-miR5643a

Accession MIMAT0022404
Sequence

61 - 

aggcuuuuaagaucugguugc

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).