Stem-loop sequence ath-MIR5644

AccessionMI0019218 (change log)
DescriptionArabidopsis thaliana miR5644 stem-loop
Stem-loop
   ua    -         aa   uagccgguaggcacagauccgauauccuaaaauuuggaauacauaaauuag 
5'   gugg guugcggau  cgg                                                   g
     |||| |||||||||  |||                                                    
3'   cauc caacgccua  gcc                                                   a
   ag    a         ca   uaggcguacauuauauuuauuaaugaacgucuacaacugccuagauuaccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 16649994-16650138 [+]
intergenic
Database links

Mature sequence ath-miR5644

Accession MIMAT0022406
Sequence

3 - 

guggguugcggauaacggua

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).