Stem-loop sequence ath-MIR5638b

AccessionMI0019219 (change log)
DescriptionArabidopsis thaliana miR5638b stem-loop
Gene family MIPF0001350; MIR5638
Literature search

1 open access papers mention ath-MIR5638b
(1 sentences)

Stem-loop
   aacaauguuguggucuuuc         a    c     g        a    u    c        ---g    gua   c         -    a   a             --- u         auaaa             c                 acua   u    gcccaccaaauaaccauugugauuguucauaaaguguuaccuucauauuuugcaaaaccucuuaaccaaucac 
5'                    gaugagaga ugug uuggg acaauugg gcag uuga ucccuuac    guua   uga gguuugaaa guga aga cuuugguauguuu   c agaaaguaa     ugaauccaaguuu gagcacacugucuuuac    gug ggca                                                                         g
                      ||||||||| |||| ||||| |||||||| |||| |||| ||||||||    ||||   ||| ||||||||| |||| ||| |||||||||||||   | |||||||||     ||||||||||||| |||||||||||||||||    ||| ||||                                                                          
3'                    cuacucucu acac aacuc uguuaacc uguc agcu agggaaug    caau   acu ucaaacuuu cacu ucu gaaaccauacaaa   g uuuuucauu     gcuuagguucaaa cucgugugguagaaaug    cac ccgu                                                                         a
   ------------------c         c    a     a        a    u    a        auga    aaa   -         u    c   c             acu c         ----a             a                 aaac   -    aucacuauuuaagaugucggguggucuacuggugacacuaacaauuuacuuuacaaguuugagaugaaacgug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 14099737-14100205 [+]
intergenic
Database links

Mature sequence ath-miR5638b

Accession MIMAT0022407
Sequence

281 - 

acaguggucaucuggugggcu

 - 301

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).