Stem-loop sequence ath-MIR5645a

AccessionMI0019220 (change log)
DescriptionArabidopsis thaliana miR5645a stem-loop
Gene family MIPF0001280; MIR5645
Stem-loop
   u                    a                                                  caaaaaaaa       c        cuccu    cucc               a              c  uucguuuugucuguugacacaaauuuaaacccuaaauccccaaaucgauuuuauuaucugcgauuuugaagucaauguggg 
5'  uguugacuuucgaaauaaau acaaaguuuuuguugacuugucauuugagucaugucguuaaguagguuaa         uuuacgg guuaaugu     uuau    ucuguuagaacaaaa aacguuguuuauug ag                                                                                 u
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||         ||||||| ||||||||     ||||    ||||||||||||||| |||||||||||||| ||                                                                                  
3'  acaauugaaagcuuuauuua uguuucaaaaacaacugaacgguaaacucaguauagcaauuuauccaauu         aaaugcc caauuaca     aaua    agacaaucuuguuuu uugcagcaaauaac uc                                                                                 c
   a                    c                                                  cucuuaaaa       a        -----    aacu               g              u  ucuguuuuguugcaacaaaacagagaacuuuguuuauauuugggauuuagagguuuagcuaaaauaauagaguuuuagugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 17418776-17419220 [+]
intergenic
Database links

Mature sequence ath-miR5645a

Accession MIMAT0022408
Sequence

45 - 

auuugagucaugucguuaag

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).