Stem-loop sequence ath-MIR5645b

AccessionMI0019221 (change log)
DescriptionArabidopsis thaliana miR5645b stem-loop
Gene family MIPF0001280; MIR5645
Stem-loop
   c                 cg                                                                            uaaaaaa    agac          c      cucc  c  a a                         cucguuuugucuguugaaacaaauuuaaacccuaaauccucaaaucgauuucauuauuuaugauuuugaggccaagguggg 
5'  gacaaauaaaucguaaa  uuuuguugacuuuugaaauaaaugacaaaguuuuuguugacuugucauuugagucaugucguuaaguagguuaaca       uuua    guuaaugucu guuuau    uc gu a aacaaaacaacguuguuuauugaag                                                                                 u
    |||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||    |||||||||| ||||||    || || | |||||||||||||||||||||||||                                                                                  
3'  cuguuuauuuagcauuu  aaaacaacugaaagcuuuguuuacuguuucaaaaacaacugaacgguaaacucaguauagcaauuuauccaauugu       aaau    caauuacaga caaaua    ag ca u uuguuuuguugcaacaaauaacuuc                                                                                 c
   u                 ca                                                                            cuuaaaa    gcca          a      aacu  a  a c                         ucuguuuugcugcagcaaaacagagaacuuuguuuauauuuggaauuuagagguuuagcuauaguaauagaguuuuagugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 4889421-4889914 [+]
intergenic
Database links

Mature sequence ath-miR5645b

Accession MIMAT0022409
Sequence

67 - 

auuugagucaugucguuaag

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).