Stem-loop sequence ath-MIR5646

AccessionMI0019222 (change log)
DescriptionArabidopsis thaliana miR5646 stem-loop
Stem-loop
   ca  a      a   a   gc  a  acuaa     c 
5'   uc ccaacg gcu uug  cc au     aucuc g
     || |||||| ||| |||  || ||     |||||  
3'   ag gguugc cgg agc  gg ua     uggag u
   gg  -      a   -   uu  a  ----g     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 3517383-3517452 [-]
intergenic
Database links

Mature sequence ath-miR5646

Accession MIMAT0022410
Sequence

51 - 

guucgaggcacguugggagg

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).