Stem-loop sequence ath-MIR5647

AccessionMI0019223 (change log)
DescriptionArabidopsis thaliana miR5647 stem-loop
Stem-loop
   a               ccau          au             ccu      c  a       a   cc            -------   a      a       a       u  c    gaua   g        a      u      c       g   c   aaa     a a   u       u     -------------      cg 
5'  uuaaauccucaagaa    acagcuugau  gagagucuucaaa   gagucg ca caaacuu acc  cuuuaaauauau       aca aaggua agaaacc auuuuga uu ggau    aaa acaacaca uggaga uuaaau caccaaa ucg aca   auaga c aga aggcauc uaacu             cucuaa  u
    |||||||||||||||    ||||||||||  |||||||||||||   |||||| || ||||||| |||  ||||||||||||       ||| |||||| ||||||| ||||||| || ||||    ||| |||||||| |||||| |||||| ||||||| ||| |||   ||||| | ||| ||||||| |||||             ||||||   
3'  aauuuaggaguucuu    uguugaauua  cucucagagguuu   cuuagc gu guuugaa ugg  gagauuuaugua       ugu uuccau ucuuugg uaaaacu aa ccua    uuu uguugugu aucucu aguuua gugguuu agc ugu   uaucu g ucu uccguag auuga             gagauu  u
   c               aucc          au             uac      a  a       c   aa            ucguaac   g      a       c       u  a    auag   a        a      c      a       a   u   aca     c c   u       u     uuccaagguuucu      uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 22084264-22084683 [-]
intergenic
Database links

Mature sequence ath-miR5647

Accession MIMAT0022411
Sequence

354 - 

ucaaguuugaugacgauucca

 - 374

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).