Stem-loop sequence ath-MIR5648

AccessionMI0019224 (change log)
DescriptionArabidopsis thaliana miR5648 stem-loop
Stem-loop
   cuuca                     c        cu      guuau   uc    g       a   -ua         g              aa       ----      a     u    u      g           cu               a              c   --au           c          c        a  uu    auu              ----u  uuu      a 
5'      ucaucacuagacucauguuuu uaaccuuu  cauucc     gaa  auag uugaaag ugg   ugaucugua ggucucuuggcauu  aacauug    auuaaa ggugu ugcc cuauuu cuucagauugu  uuuuaauguuuggaa uauuuggcuugacu ugu    gaaaaaaaagu aaguuucaau aagugaau ua  ggaa   uauagcuuccaagu     uc   uuaaag u
        ||||||||||||||||||||| ||||||||  ||||||     |||  |||| ||||||| |||   ||||||||| ||||||||||||||  |||||||    |||||| ||||| |||| |||||| |||||||||||  ||||||||||||||| |||||||||||||| |||    ||||||||||| |||||||||| |||||||| ||  ||||   ||||||||||||||     ||   ||||||  
3'      aguagugaucugaguacagaa auuggaaa  guaagg     uuu  uauc aacuuuc acc   auuagacgu ccagagaacuguaa  uuguaac    ugauuu ccgca acgg gauaaa gaagucuaaca  gaaguuacaaaccuu auaaaccgaacuga aca    cuuuuuuuuua uucaaaguua uucacuua au  ccuu   auaucgaagguuua     ag   aauuuu g
   -----                     a        au      aauuu   uu    g       a   uag         a              aa       cgau      c     u    c      a           ac               -              a   aaac           a          a        -  cu    -au              uauau  -cu      g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 11499384-11499883 [+]
intergenic
Database links

Mature sequence ath-miR5648-5p

Accession MIMAT0022412
Sequence

151 - 

uuuggaaauauuuggcuugacu

 - 172

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ath-miR5648-3p

Accession MIMAT0022413
Sequence

364 - 

aucugaagaaaauagcggcau

 - 384

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).