Stem-loop sequence ath-MIR5645c

AccessionMI0019225 (change log)
DescriptionArabidopsis thaliana miR5645c stem-loop
Gene family MIPF0001280; MIR5645
Stem-loop
   c      g                      a     -uu       a         uc       cug                 a           uacagagacaaacgacgucguuuuaucuguugaaacaaauuuuaaacccuaaauccccaaaucgauuucauuaucucaaauccuauagaggccg 
5'  ccauuu agucauguuguuaaauagguua uagaa   uuuuacg cguuaaugu  cguuuau   cucuguuagaacaaaac augucguuuau                                                                                              a
    |||||| |||||||||||||||||||||| |||||   ||||||| |||||||||  |||||||   ||||||||||||||||| |||||||||||                                                                                              a
3'  gguaaa ucaguacagcaauuuauccaau guuuu   aaaaugc gcaauuaca  gcaaaua   gagauaauuuuguuuug uacaguagaug                                                                                              u
   c      g                      a     uau       c         ga       aaa                 c           aaguugaaggaagaaggcaaaaaagaaaaaaaaaaagcuaaacuaaacccgacuccuuguaacaaacagaggaguggucuacccuaaguuuagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 14742421-14742804 [+]
intergenic
Database links

Mature sequence ath-miR5645c

Accession MIMAT0022414
Sequence

356 - 

aaccuauuuaacgacaugacu

 - 376

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).