Stem-loop sequence ath-MIR5649a

AccessionMI0019226 (change log)
DescriptionArabidopsis thaliana miR5649a stem-loop
Gene family MIPF0001369; MIR5649
Stem-loop
   u                                           aaaau 
5'  ucauauuauaguaaccaacauauucaauacuuucaaaugaaga     a
    |||||||||||||||||||||||||||||||||||||||||||     a
3'  aguauaauaucauugguuguauaaguuaugaaaguuuacuucu     u
   a                                           acggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 21360151-21360251 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR5649a
ath-MIR5649bchr1: 21360151-21360251 [-]
ath-MIR5649achr1: 21360151-21360251 [+]
Database links

Mature sequence ath-miR5649a

Accession MIMAT0022415
Sequence

73 - 

auugaauauguugguuacuau

 - 93

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).