Stem-loop sequence ath-MIR5650

AccessionMI0019227 (change log)
DescriptionArabidopsis thaliana miR5650 stem-loop
Stem-loop
   a                                 c   ucc 
5'  uuuguuuuggaucuuagauacacauauaguuug uuu   u
    ||||||||||||||||||||||||||||||||| |||    
3'  aaacaaaacuuagaaucuauguguauaucaaac aaa   u
   c                                 -   uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 19686957-19687039 [+]
intergenic
Database links

Mature sequence ath-miR5650

Accession MIMAT0022416
Sequence

3 - 

uuguuuuggaucuuagauaca

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).