Stem-loop sequence ath-MIR5651

AccessionMI0019233 (change log)
DescriptionArabidopsis thaliana miR5651 stem-loop
Stem-loop
   uggcuccgaauggagacgugcaguucaacugc    ---aa     u                   a   auaua      ca 
5'                                 ggau     agugu gugcgguucaaauaguaac aaa     uacaua  u
                                   ||||     ||||| ||||||||||||||||||| |||     ||||||   
3'                                 cuug     ucacg caugcuaaguuuaucauug uuu     auguau  a
   ---ccaucacuauauccgaagcuuaccacugg    gcaug     u                   c   aagaa      au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 17178447-17178608 [+]
intergenic
Database links

Mature sequence ath-miR5651

Accession MIMAT0022422
Sequence

43 - 

uugugcgguucaaauaguaac

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).