Stem-loop sequence ath-MIR5652

AccessionMI0019235 (change log)
DescriptionArabidopsis thaliana miR5652 stem-loop
Stem-loop
   ------------------caugaauuagaguguugaaugugaaugaaucgggcugauaucccauuuccaccaucugaccaacaagagauacggcaucugaaauccuauucccguga   -    ca     -cagaga      c    -   ua   ggcucauagccgaguuucaucaucuuggcaagaacagcuaaagcaagagagagcugagagcgucggcagaaacagu 
5'                                                                                                                     cag aaac  uugag       guuaag guga caa  ucg                                                                            u
                                                                                                                       ||| ||||  |||||       |||||| |||| |||  |||                                                                             
3'                                                                                                                     guc uuug  aacuc       cgauuc uacu guu  agc                                                                            g
   ucuauacuaaugucuuuuuauagcuauuuauccgauuuacuaaacuucgaucuacuacgccaauuagacaagccacuguaccaguucagagcaggaaagggaagcuaacaacucaa   a    ac     acgguaa      -    u   ca   uagaacaguagagagagccgcucgucuacguuuuaaacccuuaaaguguauuagaaauguguaugucauaagagua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 23412989-23413436 [-]
intergenic
Database links

Mature sequence ath-miR5652

Accession MIMAT0022424
Sequence

15 - 

uugaaugugaaugaaucgggc

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).