Stem-loop sequence ath-MIR5653

AccessionMI0019236 (change log)
DescriptionArabidopsis thaliana miR5653 stem-loop
Stem-loop
   c     --      -  ug      c     auu     c  a 
5'  ccaau  aacuca uu  acccau aacuc   ugagu aa a
    |||||  |||||| ||  |||||| |||||   ||||| || a
3'  gguug  uugagu ga  ugggua uuggg   acuca uu a
   c     ag      u  gu      c     auu     a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 19026915-19027000 [-]
intergenic
Database links

Mature sequence ath-miR5653

Accession MIMAT0022425
Sequence

63 - 

uggguugaguugaguugaguuggc

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).