Stem-loop sequence ath-MIR5655

AccessionMI0019238 (change log)
DescriptionArabidopsis thaliana miR5655 stem-loop
Stem-loop
                                                                                                                  aa    uuauaca      acu        -    ga   -aau    uacca     ag     ggagagaggucuuggaagagaggcggagaagcagagaugacauagcuaauagcuucgcuugguugcucugugu 
5' acaucaaguaaggguugguggugguggaggaggaggagaacauacgaaggguacuguggcggcaucucuggggaagaguaagaaguagacacauaagaaggagaaaaacga  gagg       aaaaga   agagagag gaua  uuu    uaau     gagaa  uuugc                                                                         g
   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||       ||||||   |||||||| ||||  |||    ||||     |||||  |||||                                                                         u
3' uguaguucauucccaaccaccaccaccuccuccuccucuuguaugcuucccaugacaccgccguagagaccccuucucauucuucaucuguguauucuuccucuuuuugcu  cucu       uuuuuu   ucucuuuc cugu  aga    auua     cucuu  ggaug                                                                         u
                                                                                                                  --    uugcacc      auu        u    ag   gauc    -uuaa     -g     aagaggaaaaagaacaccguucgugaaaccagaauuaaucuagaacugauugagcuuuugggaaaucucuucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 18902541-18903035 [+]
intergenic
Database links

Mature sequence ath-miR5655

Accession MIMAT0022427
Sequence

83 - 

aaguagacacauaagaaggag

 - 103

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).