Stem-loop sequence ath-MIR5656

AccessionMI0019240 (change log)
DescriptionArabidopsis thaliana miR5656 stem-loop
Stem-loop
                         a  uuu           u   a        c    u         c      u 
5' aucuuucuugacaaaucauaac ac   gguuaaaaggu ucg aaacucaa cucu cuucagucu ucucuu c
   |||||||||||||||||||||| ||   ||||||||||| ||| |||||||| |||| ||||||||| |||||| c
3' uggaaggagcuguuuaguauug ug   ccgguuuucca agc uuuggguu gaga gaagucaga agggaa a
                         c  uac           u   c        a    u         a      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 1727263-1727415 [+]
intergenic
Database links

Mature sequence ath-miR5656

Accession MIMAT0022429
Sequence

89 - 

acugaaguagagauuggguuu

 - 109

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).