Stem-loop sequence ath-MIR5659

AccessionMI0019243 (change log)
DescriptionArabidopsis thaliana miR5659 stem-loop
Stem-loop
       -                    cuug 
5' uauc uuucaaagaccuucauuguu    a
   |||| ||||||||||||||||||||     
3' augg aagguuucuggaaguagcag    a
       c                    cuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 16409804-16409862 [-]
intergenic
Database links

Mature sequence ath-miR5659

Accession MIMAT0022432
Sequence

37 - 

cgaugaaggucuuuggaacggua

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).