Stem-loop sequence ath-MIR5645d

AccessionMI0019244 (change log)
DescriptionArabidopsis thaliana miR5645d stem-loop
Gene family MIPF0001280; MIR5645
Stem-loop
   u           u                                   u                au                        c      cucc                              cagcucguuuucucuauugaaacaaauuuaaaccuuaaauucccaaaucgauuuuauuaucugcgauuuugaggucaauguggguaugugauuuugagauaa 
5'  uucgaaauaaa gacaaaguuuuuguugacuugucauuugagucaug cguuaaguagguugac  aauuuuuuuacggcguuaaugucu guuuau    ucuguuagaacaaaacaacguuguuuauug                                                                                                      u
    ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||  |||||||||||||||||||||||| ||||||    ||||||||||||||||||||||||||||||                                                                                                       
3'  aagcuuuauuu cuguuuuaaaaacaacugaacgguaaacucaguau gcaauuuauccaauug  uuaaaaaaaugccgcaauuacaga caaaua    agauaaucuuguuuuguugcagcaaauaac                                                                                                      g
   a           u                                   u                cc                        a      aauu                              uuuucuguuuugcugcaacaaaaaaaaaaaaaaaaaaaagaaaaaaaaaauuuugcugcaacaaaacagagaacuuuauuuauauuuggggauuuagcuaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 16116572-16117041 [+]
intergenic
Database links

Mature sequence ath-miR5645d

Accession MIMAT0022433
Sequence

37 - 

auuugagucaugucguuaag

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).