Stem-loop sequence ath-MIR5660

AccessionMI0019245 (change log)
DescriptionArabidopsis thaliana miR5660 stem-loop
Stem-loop
   uuu                          a   ---caa   ca   c            g         a           c   ccguau      -  ca 
5'    gacauaauaguuuucugguaacuuuc gac      ggc  aac gaauugucaggu guuagugca uggaaagcugg aaa      gaguau ac  u
      |||||||||||||||||||||||||| |||      |||  ||| |||||||||||| ||||||||| ||||||||||| |||      |||||| ||   
3'    uuguauuaucaaaaggccauugaaag cug      ccg  uug cuuaacagucua caaucacgu accuuucgacc uuu      cucaug ug  c
   ---                          g   uuuuug   ac   c            g         a           a   ------      a  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 5292626-5292820 [-]
intergenic
Database links

Mature sequence ath-miR5660

Accession MIMAT0022434
Sequence

53 - 

caggugguuagugcaauggaa

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).