Stem-loop sequence ath-MIR1888b

AccessionMI0019247 (change log)
DescriptionArabidopsis thaliana miR1888b stem-loop
Gene family MIPF0001333; MIR1888
Literature search

1 open access papers mention ath-MIR1888b
(1 sentences)

Stem-loop
                   c      u     g          u            cuu         cu 
5' uauuggugguaucuua ccaaau cuuag cuaagauuug gaagaaaaggcu   auauaagag  u
   |||||||||||||||| |||||| ||||| |||||||||| ||||||||||||   |||||||||   
3' auaaucaccauagaau gguuua gaauu gauucuaaac cuucuuuuuuga   uauauucuc  u
                   c      -     a          c            auu         au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 22537283-22537417 [+]
intergenic
Database links

Mature sequence ath-miR1888b

Accession MIMAT0022436
Sequence

26 - 

uuaggcuaagauuugugaaga

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).