Stem-loop sequence ath-MIR5661

AccessionMI0019249 (change log)
DescriptionArabidopsis thaliana miR5661 stem-loop
Stem-loop
   ua       c  c       cu      -guuuu  ugua 
5'   agaggua au auguagu  gaaaug      gc    c
     ||||||| || |||||||  ||||||      ||     
3'   ucuucau ug uacgucg  cuuuac      cg    u
   ug       c  u       uu      agucuu  uuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 10449329-10449409 [+]
intergenic
Database links

Mature sequence ath-miR5661

Accession MIMAT0022438
Sequence

3 - 

agagguacaucauguagucug

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).