Stem-loop sequence ath-MIR5662

AccessionMI0019250 (change log)
DescriptionArabidopsis thaliana miR5662 stem-loop
Stem-loop
             a  g         u   c        a        a          a       a     a                             uau             a    aauauuuacuuuuu       u 
5' cauuuuuaau gu aucuuuaua uuu cucuauuu uagaggug cucuauuuua aggcauu uguuc aauggucaccucuaaaauagaguuuucuc   aauagaggaagaa uaga              gucucua a
   |||||||||| || ||||||||| ||| |||||||| |||||||| |||||||||| ||||||| ||||| |||||||||||||||||||||||||||||   ||||||||||||| ||||              |||||||  
3' guagagguua ca uggagauau aaa gagauaaa aucuccac gagauaaaau uucguaa acgag uuaccaguggagauuuuaucucaaaggag   uuaucuucuuuuu aucu              uagagau a
             c  g         u   a        -        g          c       c     g                             uuu             a    cuacuuaacaucuc       a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 16798584-16798870 [+]
intergenic
Database links

Mature sequence ath-miR5662

Accession MIMAT0022439
Sequence

268 - 

agaggugaccauuggagaug

 - 287

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).