Stem-loop sequence ath-MIR5663

AccessionMI0019251 (change log)
DescriptionArabidopsis thaliana miR5663 stem-loop
Stem-loop
   u                               auucuaguauauaguaacauuau 
5'  uauagcuaaggauuugcauucucaugauuga                       a
    |||||||||||||||||||||||||||||||                        
3'  auaucgauuccuaaacguaagaguacuaacu                       g
   u                               caaaucacaaauaucugaaagaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 18686855-18686966 [-]
intergenic
Database links

Mature sequence ath-miR5663-5p

Accession MIMAT0022440
Previous IDsath-miR5663
Sequence

5 - 

agcuaaggauuugcauucuca

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ath-miR5663-3p

Accession MIMAT0032129
Sequence

88 - 

ugagaaugcaaauccuuagcu

 - 108

Get sequence
Evidence not experimental

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).