Stem-loop sequence ath-MIR5645f

AccessionMI0019252 (change log)
DescriptionArabidopsis thaliana miR5645f stem-loop
Gene family MIPF0001280; MIR5645
Stem-loop
   -                  uau           u     a             a           g            uc                   c                          c      cuc  a                    c  c       cucguuuugucuguugaaacaaauuuaaacccuaaaucccuaaaucgauuucauuaucugcgauuuugaggucaauguggg 
5'  cggaagacaaauaaaucg   aguuuuuguug uuuuc aaauaaaugacaa guuuuuguuga uugucauuugag  augucguuaaguagguuaa agaauuuuuuuacggcguuaaugucu guuuau   cu uguuagaacaaaacaacguu uu auugcag                                                                                 u
    ||||||||||||||||||   ||||||||||| ||||| ||||||||||||| ||||||||||| ||||||||||||  ||||||||||||||||||| |||||||||||||||||||||||||| ||||||   || |||||||||||||||||||| || |||||||                                                                                  
3'  gucuucuguuuauuuagc   ucaaaaacaac gaaag uuuauuuacuguu caaaaacaacu aacgguaaacuc  uauaguaauuuauucaauu uuuuaaaaaaaugccgcaauuacaga caaaua   ga acaaucuuguuuuguugcag aa uaacguc                                                                                 c
   u                  ugu           u     c             -           g            --                   -                          a      aau  a                    c  a       ucugcuuugcugcaacaaaacagaaaacuuuguuuauauuugggauuaaaggguuuaacuaaaguaauagaguuuuagucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 14946671-14947169 [-]
intergenic
Database links

Mature sequence ath-miR5645f

Accession MIMAT0022441
Sequence

71 - 

auuugagucaugucguuaag

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).