Stem-loop sequence ath-MIR5664

AccessionMI0019253 (change log)
DescriptionArabidopsis thaliana miR5664 stem-loop
Stem-loop
   u              a         a                               ugca         g  ac   ca    ---a       ----g   auu   a 
5'  ugucgucuaugaug auauaguca uuuuaucggucugcaauaggcaaauaaaaca    auuacuuug uc  gga  aauu    uuuuuau     gcu   gag c
    |||||||||||||| ||||||||| |||||||||||||||||||||||||||||||    ||||||||| ||  |||  ||||    |||||||     |||   ||| c
3'  acagcagauacuau uauaucagu aaaauagccagauguuauccguuuauuuugu    uaaugaaac ag  ccu  uuag    aaaaaua     uga   uuc a
   u              a         g                               cuac         a  ca   -a    caua       aauaa   -au   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 17386795-17387008 [+]
intergenic
Database links

Mature sequence ath-miR5664

Accession MIMAT0022442
Sequence

19 - 

auagucaauuuuaucggucug

 - 39

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).