Stem-loop sequence ath-MIR5665

AccessionMI0019254 (change log)
DescriptionArabidopsis thaliana miR5665 stem-loop
Stem-loop
   c      uc                ucu                c                            a a      uuc                 a            uc           a               a  u  a  -     aauugcauauaauuuuauuuaaauaauauguuauaucagagacaaguucauaucgaaugaguaauaaaaucagaucagga 
5'  uuguuu  gauuucaucauuuuuc   auuauuaugaauucca aucuugucuaccaauuguuuucauuuaa g uuuuga   uuauuuagauuuuucac aucuauuuuggu  acagauuaguu agcauuauugucuuc cc ac cg uuuau                                                                                a
    ||||||  ||||||||||||||||   |||||||||||||||| |||||||||||||||||||||||||||| | ||||||   ||||||||||||||||| ||||||||||||  ||||||||||| ||||||||||||||| || || || |||||                                                                                 
3'  aacaga  cuaaaguaguagaaag   uaauaguacuuagggu uagaacaggugguuaacaggaguaaauu c aaagcu   aauaaaucuaaaaagug uagauaaaacca  ugucuaaucaa ucguaauaacagaag gg ug gc aaaua                                                                                c
   a      ga                uuu                c                            c c      uaa                 g            ga           c               a  c  g  u     acuaaaaaaagaaagauaacguuuuauugguuuuuuaguucaauauaguauaauagaacagaugguaagcuagacuuaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 19499055-19499533 [-]
intergenic
Database links

Mature sequence ath-miR5665

Accession MIMAT0022443
Sequence

421 - 

uugguggacaagaucugggau

 - 441

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).