Stem-loop sequence ath-MIR5666

AccessionMI0019255 (change log)
DescriptionArabidopsis thaliana miR5666 stem-loop
Stem-loop
                 a       u      c  a      aaaa 
5' auuaaaugcucgau uuccaug ugaaac uu ucaggu    a
   |||||||||||||| ||||||| |||||| || ||||||    u
3' uaauuuacgagcua aggguac acuuug aa agucca    g
                 c       c      a  c      ggaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 12035047-12035135 [+]
intergenic
Database links

Mature sequence ath-miR5666

Accession MIMAT0022444
Sequence

69 - 

augggacaucgagcauuuaau

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).