Stem-loop sequence ath-MIR5643b

AccessionMI0019256 (change log)
DescriptionArabidopsis thaliana miR5643b stem-loop
Gene family MIPF0001348; MIR5643
Stem-loop
   g        aa   cg  u      uu  cu         cu 
5'  uguagccg  guc  ua gagucu  gu  uuguauccu  a
    ||||||||  |||  || ||||||  ||  |||||||||   
3'  gcguuggu  uag  au uucgga  ca  aauauagga  a
   a        -c   -a  u      uu  -u         ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 11757140-11757222 [-]
intergenic
Database links

Mature sequence ath-miR5643b

Accession MIMAT0022445
Sequence

61 - 

aggcuuuuaagaucugguugc

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).